Journal: Neurotherapeutics

Article Title: Alterations in Gene and Protein Expression of Cannabinoid CB 2 and GPR55 Receptors in the Dorsolateral Prefrontal Cortex of Suicide Victims

doi: 10.1007/s13311-018-0610-y

Figure Lengend Snippet: CB2r A isoform and GPR55 gene expression analyses in the DLPFC of suicide victims by real-time PCR. (A. and B.) Total RNA integrity number (RIN) evaluation in the DLPFC of suicide victims and control subjects: (A.) Representative electropherogram images of mean RIN values from DLPFC, (B.) RIN values summary table, gray boxes contain global mean values ± SEM. (C.) Relative gene expression of CB2r A isoform and (D.) GPR55 gene expression in DLPFC of suicide victims (n = 18) and their corresponding control group (n = 15). Asterisks indicate values from suicide victims that are significantly different (p < 0.05) from control subjects. Columns represent the mean and the vertical line ± the standard error of the mean (SEM) of 2-ΔΔCt

Article Snippet: Relative CB 2 r A isoform and GPR55 gene expression levels were measured using Taqman Gene Expression Assays (CB 2 r A isoform primer pair and probe were as follows: forward, GGAAGAAAGAGAATATTGTTCAGTTGATT, reverse, GCTGGCCTTGGAGAGTGACA, MGB Taqman probe, CCAGATGCAGCCGC; GPR55 Mm02621622_m1) [ 45 ] as a double-stranded DNA-specific fluorescent dye and performed on the StepOne Sequence Detector System (Applied Biosystems, Madrid, Spain).

Techniques: Gene Expression, Real-time Polymerase Chain Reaction, Control

Journal: Neurotherapeutics

Article Title: Alterations in Gene and Protein Expression of Cannabinoid CB 2 and GPR55 Receptors in the Dorsolateral Prefrontal Cortex of Suicide Victims

doi: 10.1007/s13311-018-0610-y

Figure Lengend Snippet: Protein expression analyses of CB2r and GPR55 in DLPFC suicide victims by western blot. (A.) Protein expression levels of CB2r and (B.) GPR55 in DLPFC of suicide victims (n = 18) and their corresponding control group (n = 15). Representative immunoblots of (C.) CB2r and (D.) GPR55 protein expression. Asterisks indicate values from suicide victims that are significantly different (p < 0.05) from control subjects. Data are expressed as mean ± SEM of arbitrary units (A.U)

Article Snippet: Relative CB 2 r A isoform and GPR55 gene expression levels were measured using Taqman Gene Expression Assays (CB 2 r A isoform primer pair and probe were as follows: forward, GGAAGAAAGAGAATATTGTTCAGTTGATT, reverse, GCTGGCCTTGGAGAGTGACA, MGB Taqman probe, CCAGATGCAGCCGC; GPR55 Mm02621622_m1) [ 45 ] as a double-stranded DNA-specific fluorescent dye and performed on the StepOne Sequence Detector System (Applied Biosystems, Madrid, Spain).

Techniques: Expressing, Western Blot, Control

Journal: Neurotherapeutics

Article Title: Alterations in Gene and Protein Expression of Cannabinoid CB 2 and GPR55 Receptors in the Dorsolateral Prefrontal Cortex of Suicide Victims

doi: 10.1007/s13311-018-0610-y

Figure Lengend Snippet: Pearson coefficient correlation for CB 2 r and GPR55 gene expressions and RIN, PMI, PMR and age variables for controls and suicides cases

Article Snippet: Relative CB 2 r A isoform and GPR55 gene expression levels were measured using Taqman Gene Expression Assays (CB 2 r A isoform primer pair and probe were as follows: forward, GGAAGAAAGAGAATATTGTTCAGTTGATT, reverse, GCTGGCCTTGGAGAGTGACA, MGB Taqman probe, CCAGATGCAGCCGC; GPR55 Mm02621622_m1) [ 45 ] as a double-stranded DNA-specific fluorescent dye and performed on the StepOne Sequence Detector System (Applied Biosystems, Madrid, Spain).

Techniques: Control

Journal: Neurotherapeutics

Article Title: Alterations in Gene and Protein Expression of Cannabinoid CB 2 and GPR55 Receptors in the Dorsolateral Prefrontal Cortex of Suicide Victims

doi: 10.1007/s13311-018-0610-y

Figure Lengend Snippet: CB2-GPR55 receptor heteromer expression in human prefrontal cortex. In situ proximity ligation assays were performed as described in Materials and Methods using control (A, A’, A”) and suicidal (C, C’, C”) human brain sections. A” and C” are magnification images of fields (white-dotted rectangles) in, respectively, A’ and C’. Confocal microscopy images (superimposed sections) are shown; heteromers appear as red clusters and Hoechst-stained nuclei appear in blue. (B) Shows the ratio (number of red spots/cell-containing spots) for the indicated samples. Data are the mean ± SEM of counts in 5–7 different fields (each image covered an area of 59,692 μm2) from every sample from controls (n = 7) or suicidal (n = 6). Student’s t test analysis showed significant inter-group differences on ratio of PLA spots. Asterisks indicate values from suicide victims that are significantly different (p < 0.05) from control subjects. (D) A negative control obtained by omitting one of the primary antibodies is shown. Scale bars: 50 μm (A, A’, C, C′), 10 μM (A”, C”)

Article Snippet: Relative CB 2 r A isoform and GPR55 gene expression levels were measured using Taqman Gene Expression Assays (CB 2 r A isoform primer pair and probe were as follows: forward, GGAAGAAAGAGAATATTGTTCAGTTGATT, reverse, GCTGGCCTTGGAGAGTGACA, MGB Taqman probe, CCAGATGCAGCCGC; GPR55 Mm02621622_m1) [ 45 ] as a double-stranded DNA-specific fluorescent dye and performed on the StepOne Sequence Detector System (Applied Biosystems, Madrid, Spain).

Techniques: Expressing, In Situ, Ligation, Control, Confocal Microscopy, Staining, Negative Control

Journal: Neurotherapeutics

Article Title: Alterations in Gene and Protein Expression of Cannabinoid CB 2 and GPR55 Receptors in the Dorsolateral Prefrontal Cortex of Suicide Victims

doi: 10.1007/s13311-018-0610-y

Figure Lengend Snippet: In situ proximity ligation-based detection of cellular types expressing CB2-GPR55 receptor heteromers. Panel 1A–1D: Expression of CB2-GPR55 receptor heteromers (PLA-detected, red channel) in astrocytes (GFAP immunostain; green channel). TOPRO3-counterstain was used to disclose cell nuclei. 1B and 1D are insets taken from 1A and 1C, respectively, to illustrate the expression of CB2r-GPR55 receptor heteromers in astrocytes. Cortical neurons also expressed heteromeric complexes made of CB2r and GPR55 receptors. Panels 1A–1B were taken from control samples whereas panels 1C–1D belong to suicide cases. Panel 2A–2D: Expression of CB2r-GPR55 receptor heteromers (PLA-detected, red channel) in microglial cells (Iba1 immunostain; green channel). TOPRO3-counterstain was used to disclose cell nuclei. 2B and 2D are insets taken from 2A and 2B, respectively, to properly illustrate the expression of CB2r-GPR55 receptor heteromers in microglial cells. Cortical neurons also expressed heteromeric complexes made of CB2r and GPR55 receptors. Panels 1A–1B were taken from control samples whereas panels 2C–D belong to suicide cases. Scale bars are 800 μm for low-magnification panels and 10 μm for insets. Panel 3A–3D: Identification of CB2r-GPR55 receptor heteromers in layer V cells of the PFC cortex of control samples (3A–3C) and suicide patients (3D–3F). CB2r-GPR55 heteromers were observed both in neurons (labeled as N) as well as in glial cells (G; presumed astrocytes). Scale bar is 10 μm in all panels

Article Snippet: Relative CB 2 r A isoform and GPR55 gene expression levels were measured using Taqman Gene Expression Assays (CB 2 r A isoform primer pair and probe were as follows: forward, GGAAGAAAGAGAATATTGTTCAGTTGATT, reverse, GCTGGCCTTGGAGAGTGACA, MGB Taqman probe, CCAGATGCAGCCGC; GPR55 Mm02621622_m1) [ 45 ] as a double-stranded DNA-specific fluorescent dye and performed on the StepOne Sequence Detector System (Applied Biosystems, Madrid, Spain).

Techniques: In Situ, Ligation, Expressing, Control, Labeling

Journal: Scientific Reports

Article Title: Increased Risk of Psoriasis due to combined effect of HLA-Cw6 and LCE3 risk alleles in Indian population

doi: 10.1038/srep24059

Figure Lengend Snippet: Allele frequencies of the SNPs near LCE3 and CNV of LCE3C-3B.

Article Snippet: Three taqman probe-primers (LCE3A Hs00820288_s1, LCE3B Hs04193180_s1, LCE3C Hs00708773_s1; Applied Biosystems) were used to determine the copy number variations in ~10% of the samples along with two known positive controls having homozygous deleted and non-deleted alleles, and a negative control (no template).

Techniques: Control

Journal: Scientific Reports

Article Title: Increased Risk of Psoriasis due to combined effect of HLA-Cw6 and LCE3 risk alleles in Indian population

doi: 10.1038/srep24059

Figure Lengend Snippet: Combined effect of HLA-Cw6 with LCE3 risk and non-risk genotypes.

Article Snippet: Three taqman probe-primers (LCE3A Hs00820288_s1, LCE3B Hs04193180_s1, LCE3C Hs00708773_s1; Applied Biosystems) were used to determine the copy number variations in ~10% of the samples along with two known positive controls having homozygous deleted and non-deleted alleles, and a negative control (no template).

Techniques:

Journal: Scientific Reports

Article Title: Increased Risk of Psoriasis due to combined effect of HLA-Cw6 and LCE3 risk alleles in Indian population

doi: 10.1038/srep24059

Figure Lengend Snippet: Stratification based on HLA-Cw6 showed significant association of LCE3 SNPs and LCE3C-3B deletion only in presence of HLA-Cw6.

Article Snippet: Three taqman probe-primers (LCE3A Hs00820288_s1, LCE3B Hs04193180_s1, LCE3C Hs00708773_s1; Applied Biosystems) were used to determine the copy number variations in ~10% of the samples along with two known positive controls having homozygous deleted and non-deleted alleles, and a negative control (no template).

Techniques: Control

Journal: Experimental eye research

Article Title: Glucocorticoid action in human corneal epithelial cells establishes roles for corticosteroids in wound healing and barrier function of the eye

doi: 10.1016/j.exer.2016.08.020

Figure Lengend Snippet: Glucocorticoid Receptor signaling in the adult mouse cornea. A) Immunofluorescence of wild type adult female mouse cornea showing glucocorticoid receptor expression (red) in all the layers of the corneal epithelium, in the corneal stromal cells and in the corneal endothelial cells. Phalloidin and Hoechst were used to visualize actin (green) and nuclei (blue), respectively. A merge of all three channels is presented in the fourth panel. Scale bar: 20µm. B) & C) Adrenalectomized wild type mice were treated for 6 hours with vehicle or dexamethasone eye drops and GILZ mRNA (B) and FKBP5 mRNA (C) were evaluated by quantitative RT-PCR. Results were normalized to PPIB gene expression (housekeeping gene). Data represent mean ± standard error of mean from four biological replicates. Student’s t-test was used to determine statistical significance compared to the vehicle-treated cells; *** p<0.001.

Article Snippet: Pre-developed Taqman primer probe sets for GILZ (Hs00608272_m1, Mm00726417_s1), FKBP5 (Mm00487406_m1), TNFRSF11b (Hs00900358_m1) , BDNF (Hs00380947_m1), EREG (Hs00154995_m1), NGF (Hs00171458_m1) and PPIB (Hs00168719_m1, Mm00478295_m1) were purchased from Life Technologies, Grand Island, NY.

Techniques: Immunofluorescence, Expressing, Eye Drops, Quantitative RT-PCR, Gene Expression

Journal: Experimental eye research

Article Title: Glucocorticoid action in human corneal epithelial cells establishes roles for corticosteroids in wound healing and barrier function of the eye

doi: 10.1016/j.exer.2016.08.020

Figure Lengend Snippet: Corneal epithelial cells express functional glucocorticoid receptors. A) Glucocorticoid receptor protein level expressed by immortalized human corneal epithelial (HCE) cells evaluated by immunoblot. Actin was used as the loading control. B) Nuclear translocation of glucocorticoid receptor by immunofluorescence in HCE cells treated with 100nM dexamethasone for 1 hour at 37 degrees centigrade. Glucocorticoid receptor expression is in red and Hoechst staining of the nuclei is in blue. C) HCE cells were treated with vehicle or four different concentrations of dexamethasone for 6hrs and GILZ mRNA was measure by quantitative RT-PCR. D) HCE cells were treated for 6 hours with vehicle, dexamethasone (100nM), RU486- an antagonist of glucocorticoid receptor (1000nM), or both and GILZ mRNA was evaluated by quantitative RT-PCR. Results were normalized to PPIB gene expression (housekeeping gene). Data represent mean ± standard error of mean from three or four independent experiments. Student’s t-test was used to determine statistical significance compared to the vehicle-treated cells; * p<0.05 and ** p<0.01.

Article Snippet: Pre-developed Taqman primer probe sets for GILZ (Hs00608272_m1, Mm00726417_s1), FKBP5 (Mm00487406_m1), TNFRSF11b (Hs00900358_m1) , BDNF (Hs00380947_m1), EREG (Hs00154995_m1), NGF (Hs00171458_m1) and PPIB (Hs00168719_m1, Mm00478295_m1) were purchased from Life Technologies, Grand Island, NY.

Techniques: Functional Assay, Western Blot, Control, Translocation Assay, Immunofluorescence, Expressing, Staining, Quantitative RT-PCR, Gene Expression

Journal: Clinical and Translational Medicine

Article Title: Biological significance of MYC and CEBPD coamplification in urothelial carcinoma: Multilayered genomic, transcriptional and posttranscriptional positive feedback loops enhance oncogenic glycolysis

doi: 10.1002/ctm2.674

Figure Lengend Snippet: Overexpression of CCAAT/enhancer‐binding protein delta (CEBPD) confers a pro‐proliferative phenotype in BFTC909 and TCCSUP cells. Quantitative reverse transcription‐polymerase chain reaction (RT‐PCR) and immunoblotting (A) showed that the transcript and protein levels of CEBPD were lower in the BFTC909 and TCCSUP cells among the four urothelial carcinoma (UC)‐derived cell lines. Hence, Exogenous CEBPD expression was performed in BFTC909 and TCCSUP cells to examine the biological impact of CEBPD on tumorigenesis. The mRNA (B) and protein (C) levels of CEBPD were significantly upregulated in BFTC909 and TCCSUP cells after successful exogenous expression of the CEBPD gene compared with the mock‐transfected cell lines. (D) Proliferation assay showed that overexpression of CEBPD in BFTC909 and TCCSUP significantly increased pro‐proliferative phenotype at 24–72 h after seeding compared to the mock‐transfected cells. All experiments were conducted in triplicate and results were represented as the mean ± SEM. For immunoblot assay, one representative image was shown and GAPDH was regarded as a loading control. Statistical significance: * p < .05

Article Snippet: The mixture containing cDNA, predesigned TaqMan assay reagent (probe and primer set: CEBPD [Hs00270931_m1], MYC [Hs00153408_m1], FBXW7 [Hs00217794_m1] and HK2 [Hs01034055_g1]; Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems) were subjected to quantitative RT‐PCR to determine the mRNA level via a StepOne Plus System (Applied Biosystems) at the indicated thermal cycling: 20 s at 95°C, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The cycle threshold (Ct) value of the target gene was normalized to that of the reference gene POLR2A , which served as the ∆Ct value.

Techniques: Over Expression, Binding Assay, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Western Blot, Derivative Assay, Expressing, Transfection, Proliferation Assay, Control

Journal: Clinical and Translational Medicine

Article Title: Biological significance of MYC and CEBPD coamplification in urothelial carcinoma: Multilayered genomic, transcriptional and posttranscriptional positive feedback loops enhance oncogenic glycolysis

doi: 10.1002/ctm2.674

Figure Lengend Snippet: CCAAT/enhancer‐binding protein delta (CEBPD) overexpression confers mTORC1‐driven metabolic reprogramming and leads to glucose addiction. The potential relationship between CEBPD and proteins associated with the mTOR pathway was explored by immunoblotting analysis. (A) pMAPK3/1, pPI3K, pAKT1, pMTOR, pRPS6, pEIF4EBP1 and SKP2 were significantly upregulated, while cleaved CASP3 was notably decreased in CEBPD‐overexpressing BFTC909 and TCCSUP cells treated with culture medium containing glucose compared to mock‐expressing cells. (B) 2,3‐Bis‐(2‐methoxy‐4‐nitro‐5‐sulfophenyl) 2H‐tetrazolium‐5‐carboxanilide (XTT) assay indicated that cell viability was notably inhibited in mock‐expressing BFTC909 and TCCSUP cells under glucose starvation (culture medium without glucose) for 72 h compared to mock‐expressing cells in a complete cell culture medium. Furthermore, CEBPD overexpression further exacerbated glucose withdrawal‐induced cell viability suppression in these two cell lines. (C) Immunoblotting data indicated that glucose deficiency suppresses the effect of CEBPD on the upregulation of pAKT1, pMTOR, pRPS6, pEIF4EBP1 and SKP2 protein and the downregulation of CASP3 in these two distinct UC‐derived cells. However, the protein levels of pMAPK3/1 and pPI3K were not comparable in CEBPD‐overexpressing BFTC909 and TCCSUP cells under glucose starvation conditions. Glucose uptake assay (D), lactate level analysis (E), Seahorse XFp Analyzer assessment (F–G), OCR, and MitoDsRed‐tagged fluorescent mitochondrial staining (H) were performed to evaluate the cellular glucose uptake, lactate production, oxygen consumption rate (OCR), extracellular acidification rate (ECAR) and mitochondrial status. The data showed that stable overexpression of CEBPD notably increased glucose uptake (D), lactate production (E), the ECAR (F) and mitochondrial fragmentation/fission (H) but decreased the OCR (G) in BFTC909 and TCCSUP cells compared to mock‐expressing cells. To clarify the metabolic switch from mitochondrial oxidative phosphorylation (OXPHOS) to glycolysis under CEBPD regulation, the relationship between CEBPD and hexokinase 2 ( HK2 ) was estimated through analysis of the Gene Expression Omnibus (GEO) database (GSE13507 dataset, n = 188), indicating a significantly positive correlation between the mRNA levels of CEBPD and HK2 in bladder cancer specimens (I). The result was validated by quantitative reverse transcription‐polymerase chain reaction (RT‐PCR) (J), promoter activity assay (K), and immunoblotting (L) and indicated that the transcript (J) and protein (L) levels of HK2 were markedly upregulated in CEBPD‐overexpressing BFTC909 and TCCSUP cells versus mock‐transfected cells via the upregulation of HK2 promoter activity (K). Additionally, CEBPD overexpression increased the protein level of SLC2A1 but not LDH A/C (L). All experiments were performed in triplicate and data was represented as the mean ± SE. For immunoblot assay and fluorescent image data, one representative image is displayed. GAPDH was served as a loading control for immunoblot assay. Statistical significance: * p < .05

Article Snippet: The mixture containing cDNA, predesigned TaqMan assay reagent (probe and primer set: CEBPD [Hs00270931_m1], MYC [Hs00153408_m1], FBXW7 [Hs00217794_m1] and HK2 [Hs01034055_g1]; Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems) were subjected to quantitative RT‐PCR to determine the mRNA level via a StepOne Plus System (Applied Biosystems) at the indicated thermal cycling: 20 s at 95°C, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The cycle threshold (Ct) value of the target gene was normalized to that of the reference gene POLR2A , which served as the ∆Ct value.

Techniques: Binding Assay, Over Expression, Western Blot, Expressing, XTT Assay, Cell Culture, Derivative Assay, Staining, Phospho-proteomics, Gene Expression, Reverse Transcription, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Activity Assay, Transfection, Control

Journal: Clinical and Translational Medicine

Article Title: Biological significance of MYC and CEBPD coamplification in urothelial carcinoma: Multilayered genomic, transcriptional and posttranscriptional positive feedback loops enhance oncogenic glycolysis

doi: 10.1002/ctm2.674

Figure Lengend Snippet: Collaboration of CCAAT/enhancer‐binding protein delta (CEBPD) and MYC in the regulation of SLC2A1 and HK2. (A) To assess the crosstalk between the dosage/gene expression of CEBPD and MYC , we reassessed The Cancer Genome Atlas (TCGA) bladder cancer dataset and found that 32.2% (49/152) and 46.7% (71/152) of urothelial carcinomas (UCs) showed copy number gains (CNGs) involving CEBPD and MYC , respectively. Moreover, a notably positive correlation (45/152, r = 0.427, p < .001) between CEBPD and MYC dosage was observed. The Red dashed line indicated the log2 ratio of 0.2, which represent the cut‐off of copy number gain. (B) Assessment of the GEO database (GSE13507 dataset, n = 188) identified a markedly positive relation between the transcript levels of MYC and CEBPD ( r = 0.477, p < .001). Copy number variation (CNV) profiled by real‐time PCR using three distinct probes targeting three different regions of the MYC and CEBPD chromosomes indicated that the overexpression of MYC through viral delivery systems could induce CEBPD amplification in BFTC909 and TCCSUP (D) cells but not vice versa (C). (E) Immunohistochemistry (IHC; left) and chromogenic in situ hybridization (CISH; right) assays revealed an inconsistency between the expression and gene dosage of MYC in a representative case of UTUC with MYC amplification but a low MYC expression. (F) The effect of CEBPD overexpression on the promotion of MYC transcription was not comparable in BFTC909 and TCCSUP cells, while (G) CEBPD overexpression robustly increased the protein level of MYC in both cell lines, suggesting the possibility that CEBPD exerts posttranslational regulation of MYC expression. (H) Evaluation of protein stability by cycloheximide (CHX) chase assays coupled with immunoblotting shows that MYC protein expression was restored in CEBPD‐expressing BFTC909 and TCCSUP cells compared to mock cells. The statistical results were shown in a line graph (I). Moreover, the MYC protein levels were abundantly increased in the mock‐transfected BFTC909 and TCCSUP groups treated with MG132, a ubiquitin‐proteasome inhibitor, compared to the vehicle‐treated group. MYC protein had the same effect between MG132 or vehicle treatment in CEBPD‐overexpressing BFTC909 and TCCSUP cells (J). CEBPD overexpression notably inhibited the mRNA (K) and protein (L) levels of FBXW7 in BFTC909 and TCCSUP cells. (M) CEBPD overexpression significantly suppressed FBXW7 promoter activity in BFTC909 and TCCSUP cells, confirming that CEBPD upregulates MYC expression by depleting FBXW7‐mediated MYC degradation. All experiments were executed in triplicate and the results were represented as the mean ± SEM. For immunoblot assay, IHC and CISH data, one representative image was displayed. GAPDH was shown as a loading control for immunoblot assay. Statistical significance: * p < .05

Article Snippet: The mixture containing cDNA, predesigned TaqMan assay reagent (probe and primer set: CEBPD [Hs00270931_m1], MYC [Hs00153408_m1], FBXW7 [Hs00217794_m1] and HK2 [Hs01034055_g1]; Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems) were subjected to quantitative RT‐PCR to determine the mRNA level via a StepOne Plus System (Applied Biosystems) at the indicated thermal cycling: 20 s at 95°C, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The cycle threshold (Ct) value of the target gene was normalized to that of the reference gene POLR2A , which served as the ∆Ct value.

Techniques: Binding Assay, Gene Expression, Real-time Polymerase Chain Reaction, Over Expression, Amplification, Immunohistochemistry, Chromogenic In Situ Hybridization, Expressing, Western Blot, Transfection, Ubiquitin Proteomics, Activity Assay, Control

Journal: Clinical and Translational Medicine

Article Title: Biological significance of MYC and CEBPD coamplification in urothelial carcinoma: Multilayered genomic, transcriptional and posttranscriptional positive feedback loops enhance oncogenic glycolysis

doi: 10.1002/ctm2.674

Figure Lengend Snippet: Correlations between CCAAT/enhancer‐binding protein delta (CEBPD) and MYC amplification/expression and miR‐429 and HK2 expression and other important clinicopathological parameters in urinary bladder urothelial carcinoma (UBUC)

Article Snippet: The mixture containing cDNA, predesigned TaqMan assay reagent (probe and primer set: CEBPD [Hs00270931_m1], MYC [Hs00153408_m1], FBXW7 [Hs00217794_m1] and HK2 [Hs01034055_g1]; Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems) were subjected to quantitative RT‐PCR to determine the mRNA level via a StepOne Plus System (Applied Biosystems) at the indicated thermal cycling: 20 s at 95°C, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The cycle threshold (Ct) value of the target gene was normalized to that of the reference gene POLR2A , which served as the ∆Ct value.

Techniques: Amplification, Expressing

Journal: Clinical and Translational Medicine

Article Title: Biological significance of MYC and CEBPD coamplification in urothelial carcinoma: Multilayered genomic, transcriptional and posttranscriptional positive feedback loops enhance oncogenic glycolysis

doi: 10.1002/ctm2.674

Figure Lengend Snippet: Correlations between CCAAT/enhancer‐binding protein delta (CEBPD) and MYC amplification/expression and miR‐429 and HK2 expression and other important clinicopathological parameters in upper urinary tract urothelial cancer (UTUC)

Article Snippet: The mixture containing cDNA, predesigned TaqMan assay reagent (probe and primer set: CEBPD [Hs00270931_m1], MYC [Hs00153408_m1], FBXW7 [Hs00217794_m1] and HK2 [Hs01034055_g1]; Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems) were subjected to quantitative RT‐PCR to determine the mRNA level via a StepOne Plus System (Applied Biosystems) at the indicated thermal cycling: 20 s at 95°C, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The cycle threshold (Ct) value of the target gene was normalized to that of the reference gene POLR2A , which served as the ∆Ct value.

Techniques: Amplification, Expressing

Journal: Clinical and Translational Medicine

Article Title: Biological significance of MYC and CEBPD coamplification in urothelial carcinoma: Multilayered genomic, transcriptional and posttranscriptional positive feedback loops enhance oncogenic glycolysis

doi: 10.1002/ctm2.674

Figure Lengend Snippet: CCAAT/enhancer‐binding protein delta (CEBPD) promotes HK2 expression through the transcriptional suppression of hsa‐miR‐429. (A) Immunoblotting assays confirmed that MYC, SLC2A1 and HK2 expression was markedly increased by exogenous CEBPD expression in BFTC909 and TCCSUP cells. The increase in MYC, SLC2A1 and HK2 expression induced by CEBPD overexpression was partially attenuated by two distinct MYC siRNAs in BFTC909 and TCCSUP cells, confirming the critical role of MYC in CEBPD‐driven glycolysis. (B) A putative CEBPD binding site at the hsa‐miR‐429 promoter was predicted by the JASPAR database ( http://jaspar.genereg.net/ ). (C) Moreover, a predicted targeting site of hsa‐miR‐429 on the 3′‐untranslated region (3′‐UTR) of HK2 mRNA was identified. The red font indicated the seed sequence of miRNA to the mRNA. Lowercase letters mean unmatched position while capital letters showed the matched region between miRNA and mRNA. To evaluate the regulation of HK2 expression by hsa‐miR‐429, a mutant‐ HK2 mRNA‐3′‐UTR was constructed as indicated. We identified that treatment with the miR‐429 mimic did not affect CEBPD (D) or MYC (E) transcription in BFTC909 and TCCSUP cells. Exogenous CEBPD overexpression significantly inhibited the expression (F) and promoter transactivity (G) of hsa‐miR‐429 through quantitative RT‐PCR and luciferase reporter assays, respectively, in BFTC909 and TCCSUP cells. (H) Chromatin immunoprecipitation (ChIP) indicated that CEBPD is evidently recruited to the hsa‐miR‐429 promoter region in BFTC909 and TCCSUP cells, confirming the direct binding and transcriptional regulation of CEBPD on hsa‐miR‐429. (I) Interestingly, the transcription of HK2 was robustly diminished by treatment with the miR‐429 mimic but promoted after treatment with the hsa‐miR‐429 inhibitor in BFTC909 and TCCSUP cells. Moreover, miR‐429 mimic treatment significantly inhibited the relative luciferase activity of BFTC909 and TCCSUP cells transfected with pMIR‐WT‐ HK2 ‐3′‐UTR ‐Luc but not pMIR‐mutant‐ HK2 ‐3′‐UTR‐Luc (J). (K) The transcription of HK2 was increased in CEBPD‐overexpressing BFTC909 and TCCSUP cells compared to mock‐expressing cells. However, compared with the vehicle, the miR‐429 mimic robustly inhibited the increase in HK2 transcripts in CEBPD‐overexpressing BFTC909 and TCCSUP cells. The aforementioned evidence revealed that CEBPD promotes HK2 expression through the transcriptional suppression of hsa‐miR‐429. All experiments were performed in triplicate and the results were represented as the mean ± SEM. For immunoblot assay, one representative image was displayed. GAPDH was shown as a loading control for immunoblot assay. Statistical significance: * # p < .05

Article Snippet: The mixture containing cDNA, predesigned TaqMan assay reagent (probe and primer set: CEBPD [Hs00270931_m1], MYC [Hs00153408_m1], FBXW7 [Hs00217794_m1] and HK2 [Hs01034055_g1]; Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems) were subjected to quantitative RT‐PCR to determine the mRNA level via a StepOne Plus System (Applied Biosystems) at the indicated thermal cycling: 20 s at 95°C, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The cycle threshold (Ct) value of the target gene was normalized to that of the reference gene POLR2A , which served as the ∆Ct value.

Techniques: Binding Assay, Expressing, Western Blot, Over Expression, Sequencing, Mutagenesis, Construct, Quantitative RT-PCR, Luciferase, Chromatin Immunoprecipitation, Activity Assay, Transfection, Control

Journal: Clinical and Translational Medicine

Article Title: Biological significance of MYC and CEBPD coamplification in urothelial carcinoma: Multilayered genomic, transcriptional and posttranscriptional positive feedback loops enhance oncogenic glycolysis

doi: 10.1002/ctm2.674

Figure Lengend Snippet: High expression of MYC, CCAAT/enhancer‐binding protein delta (CEBPD) and HK2 along with low FBXW7 and hsa‐miR‐429 expression predicts adverse features and poor patient outcomes in urinary bladder urothelial carcinoma (UBUC) and upper urinary tract urothelial cancer (UTUC). (A) IHC and in situ hybridization showed that MYC amplification; high expression of MYC, CEBPD, and HK2; and low expression of FBXW7 and hsa‐miR‐429 were strongly relevant to UBUC patients ( n = 295) with high tumour stage. (B–C) Moreover, Kaplan‐Meier survival analysis indicated that both MYC amplification and high MYC expression are significant survival determinants in UBUC ( n = 295; B1 and B2) and UTUC ( n = 340; C1 and C2), while the survival impacts of MYC expression can be further enriched by the coexpression of CEBPD. (B3 and C3), suggesting potential synergistic effects of MYC and CEBPD in the promotion of UC progression. In addition, low expression of miR‐429 and high expression of HK2 also confer a poor prognosis in terms of disease‐specific survival in UBUC ( n = 295; B4 and B5) and UTUC ( n = 340; C4 and C5) patients. The UBUC and UTUC cohorts were taken from the biobank of Chi Mei Medical Center that collected specimens after an operation with curative intent between January 1996 and May 2004 as previously described. ²² This study was approved by the institutional review board of Chi Mei Medical Center (IRB10207‐001). For immunohistochemistry, one representative image was shown upper urinary tract urothelial cancer (UTUC)

Article Snippet: The mixture containing cDNA, predesigned TaqMan assay reagent (probe and primer set: CEBPD [Hs00270931_m1], MYC [Hs00153408_m1], FBXW7 [Hs00217794_m1] and HK2 [Hs01034055_g1]; Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems) were subjected to quantitative RT‐PCR to determine the mRNA level via a StepOne Plus System (Applied Biosystems) at the indicated thermal cycling: 20 s at 95°C, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The cycle threshold (Ct) value of the target gene was normalized to that of the reference gene POLR2A , which served as the ∆Ct value.

Techniques: Expressing, Binding Assay, In Situ Hybridization, Amplification, Immunohistochemistry

Journal: Clinical and Translational Medicine

Article Title: Biological significance of MYC and CEBPD coamplification in urothelial carcinoma: Multilayered genomic, transcriptional and posttranscriptional positive feedback loops enhance oncogenic glycolysis

doi: 10.1002/ctm2.674

Figure Lengend Snippet: Univariate log‐rank and multivariate analyses for disease‐specific and metastasis‐free survival in upper urinary tract urothelial cancer (UTUC)

Article Snippet: The mixture containing cDNA, predesigned TaqMan assay reagent (probe and primer set: CEBPD [Hs00270931_m1], MYC [Hs00153408_m1], FBXW7 [Hs00217794_m1] and HK2 [Hs01034055_g1]; Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems) were subjected to quantitative RT‐PCR to determine the mRNA level via a StepOne Plus System (Applied Biosystems) at the indicated thermal cycling: 20 s at 95°C, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The cycle threshold (Ct) value of the target gene was normalized to that of the reference gene POLR2A , which served as the ∆Ct value.

Techniques: Amplification, Expressing

Journal: Clinical and Translational Medicine

Article Title: Biological significance of MYC and CEBPD coamplification in urothelial carcinoma: Multilayered genomic, transcriptional and posttranscriptional positive feedback loops enhance oncogenic glycolysis

doi: 10.1002/ctm2.674

Figure Lengend Snippet: Univariate log‐rank and multivariate analyses for disease‐specific and metastasis‐free survival in urinary bladder urothelial carcinoma (UBUC)

Article Snippet: The mixture containing cDNA, predesigned TaqMan assay reagent (probe and primer set: CEBPD [Hs00270931_m1], MYC [Hs00153408_m1], FBXW7 [Hs00217794_m1] and HK2 [Hs01034055_g1]; Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems) were subjected to quantitative RT‐PCR to determine the mRNA level via a StepOne Plus System (Applied Biosystems) at the indicated thermal cycling: 20 s at 95°C, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The cycle threshold (Ct) value of the target gene was normalized to that of the reference gene POLR2A , which served as the ∆Ct value.

Techniques: Amplification, Expressing

Journal: Clinical and Translational Medicine

Article Title: Biological significance of MYC and CEBPD coamplification in urothelial carcinoma: Multilayered genomic, transcriptional and posttranscriptional positive feedback loops enhance oncogenic glycolysis

doi: 10.1002/ctm2.674

Figure Lengend Snippet: Diabetes mellitus (DM) exacerbates CCAAT/enhancer‐binding protein delta (CEBPD)‐driven tumour aggressiveness. (A) Analysis of the National Health Insurance Research Database (NHIRD) showed that urinary bladder urothelial carcinoma (UBUC) (A1, n = 8436, p < .001) and upper urinary tract urothelial cancer (UTUC) (A5, n = 3232, p = .003) patients with concomitant DM had a higher death rate than non‐DM patients. However, unlike the results for the NHIRD, which includes a large number of patients, concomitant DM only displayed marginal significance for the prediction of poor disease‐specific survival (DSS) in UBUC (A2, n = 295, p = .0547) and UTUC (A6, n = 340, p = .0867) in our cohort, which includes few cases, indicating that the significance of DM in patients’ outcome might be mild. Interestingly, for those cases with high CEBPD expression in our cohort, the presence of DM conferred a significantly worse prognosis in UBUC (A3, n = 88, p = .0046) and UTUC (A7, n = 89, p = .0187). Conversely, tumours harbouring high CEBPD expression were even more aggressive in DM patients in both the UBUC (A4, n = 55, p = .0001) and UTUC (A8, n = 64, p < .0001) cohorts. The aforementioned evidence revealed that CEBPD‐mediated aggressiveness in UC can be exacerbated by concomitant hyperglycemic disorder, a symptom that characterizes diabetes, probably because high‐glucose conditions help to reinforce CEBPD‐mediated glycolysis in cancer cells. (B) Experiments on a BFTC909‐derived xenograft model ( n = 8 for each group) further reinforced that the effects of CEBPD on promoting tumour growth could be exacerbated by concomitant hyperglycemia. First, compared with the mock conditions, CEBPD overexpression promoted the growth of xenografted tumours in SCID/beige mice without high‐fat diet‐induced DM. Accelerated tumour growth driven by CEBPD overexpression was exacerbated in mice with high‐fat‐diet‐induced DM compared with those with CEBPD overexpression alone or induced DM alone (B1). The CEBPD‐induced and DM‐induced effects on tumour aggressiveness and the DM‐induced exacerbation of CEBPD‐driven tumour growth were all statistically significant (B2). (C) IHC analysis of xenografted samples at day 25 post‐injection showed that pAKT1, pMTOR, pRPS6, pEIF4EBP, MKI67, MYC and HK2 were highly expressed and that hsa‐miR‐429 were downregulated in the CEBPD‐overexpressing and/or DM‐induced groups compared to the control group. Of note, the upregulation of MYC and HK2 and downregulation of hsa‐miR‐429 were more prominent in the CEBPD‐overexpressing group than in the mock group, regardless of DM induction. This suggests that the CEBPD‐mediated effects on glycolysis might be regardless of hyperglycemia or normoglycemia conditions. For immunohistochemistry, one representative image was shown. Data are shown as the mean ± SEM. Statistical significance: * p < .05

Article Snippet: The mixture containing cDNA, predesigned TaqMan assay reagent (probe and primer set: CEBPD [Hs00270931_m1], MYC [Hs00153408_m1], FBXW7 [Hs00217794_m1] and HK2 [Hs01034055_g1]; Applied Biosystems) and TaqMan Fast Advanced Master Mix (Applied Biosystems) were subjected to quantitative RT‐PCR to determine the mRNA level via a StepOne Plus System (Applied Biosystems) at the indicated thermal cycling: 20 s at 95°C, followed by 40 cycles of 95°C for 1 s and 60°C for 20 s. The cycle threshold (Ct) value of the target gene was normalized to that of the reference gene POLR2A , which served as the ∆Ct value.

Techniques: Binding Assay, Expressing, Derivative Assay, Over Expression, Injection, Control, Immunohistochemistry